Home | About PR | Editorial board | Search | Ahead of print | Current Issue | Archives | Instructions | Subscribe | Advertise | Contact us |   Login 
Pharmacognosy Magazine
Search Article 
  
Advanced search 
 


 
 Table of Contents 
ORIGINAL ARTICLE
Year : 2019  |  Volume : 11  |  Issue : 2  |  Page : 162-170  

Bioactive secondary metabolites from the locally isolated terrestrial fungus, Penicillium sp. SAM16-EGY


1 Department of Medicinal Chemistry, Theodor Bilharz Research Institute, Giza, Egypt
2 Division of Genetic Engineering and Biotechnology, Department of Microbial Chemistry, National Research Centre, Giza, Egypt

Date of Web Publication16-Apr-2019

Correspondence Address:
Dr. Mosad A Ghareeb
Department of Medicinal Chemistry, Theodor Bilharz Research Institute, Kornish El-Nile St., Warrak El-Hader, Imbaba, Giza
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/pr.pr_102_18

Rights and Permissions
   Abstract 


Background: Penicillium is a diverse genus occurring worldwide; its species are of major importance in the natural environment as decomposer of organic materials as well as food and drug production. Objective: Chromatographic isolation and identification of its bioactive secondary metabolites and their evaluation as antimicrobial agents. Materials and Methods: Disc agar plate method has been recognized to assess the antimicrobial activities. The antioxidant activity was determined using phosphomolybdenum method. The fungus strain SAM16-EGY was isolated from soil and was molecularly identified as Penicillium sp. SAM16-EGY using 18S ribosomal ribonucleic acid technique (acc. no., KP125952). Results: Seven compounds namely 3-O-docosyl-4-benzoyloxy methyl-3-oxobicyclo (4.1.0) heptane-1,5,6,7 tetrol (3-O-docosyl-3-debenzol rotepoxide) (1), (4bE, 6Z, 8E, 9aS, 10S)-1,4-dihydroxy-9a, 10-dihydro-10,12-epoxy-5-methylbenzo[a] azulen-12-one (2), 7α,9β,15β-triacetoxy-3-β-hydroxy jatropha-5E, 11E-diene (3), sesquiterpene I diol dihexoside malonate ester (4), piperogalone (5), (5R, 8Z, 11Z)-5 β-(6'-O-malonyl-β-glucopyranozyloxy-6-hydroxy tetradeca-8, 11-dienoic acid (6), and n-trcosanyl-n-octaced-9-enoate (7) were isolated and identified from this fungus. Their structures were determined on the basis of proton nuclear magnetic resonance and carbon-13 nuclear magnetic resonance spectroscopy. Compounds 1, 2, 4, and 5 exhibited antimicrobial activities against Staphylococcus aureus, Pseudomonas aeruginosa, and Candida albicans only, whereas compound 3 exerted higher antimicrobial activity against S. aureus (9 mm), P. aeruginosa (9 mm), C. albicans (11 mm), and Aspergillus niger (13 mm) as compared to the other compounds. In the phosphomolybdenum assay, compound 5 showed high total antioxidant capacity value of 608.59 mg ascorbic acid equivalent/g compound, followed by compound 2 (443.66 mg) and compound 1 (332.16 mg). Conclusion: The isolated compounds showed promising antimicrobial and antioxidant activities.

Keywords: 18S Ribosomal ribonucleic acid, antimicrobial, antioxidant, Penicillium sp. SAM16-EGY, secondary metabolites, vacuum liquid chromatography


How to cite this article:
Ghareeb MA, Hamed MM, Saad AM, Abdel-Aziz MS, Hamed AA, Refahy LA. Bioactive secondary metabolites from the locally isolated terrestrial fungus, Penicillium sp. SAM16-EGY. Phcog Res 2019;11:162-70

How to cite this URL:
Ghareeb MA, Hamed MM, Saad AM, Abdel-Aziz MS, Hamed AA, Refahy LA. Bioactive secondary metabolites from the locally isolated terrestrial fungus, Penicillium sp. SAM16-EGY. Phcog Res [serial online] 2019 [cited 2019 May 20];11:162-70. Available from: http://www.phcogres.com/text.asp?2019/11/2/162/256293





Summary

  • The current research work concerned with isolation of fungi from the soil which were identified by the molecular techniques (18S ribosomal ribonucleic acid)
  • The promising fungal extract underwent fractionation via vacuum liquid chromatography, and then, all resulting fractions were evaluated for their antimicrobial and antioxidant activities
  • Chromatographic isolation and purification of the most active extract led to characterization of seven pure compounds which also were evaluated for their antimicrobial and antioxidant activities.




Abbreviations Used: 18SrRNA: 18S Ribosomal ribonucleic acid; TAC: Total antioxidant capacity; AAE: Ascorbic acid equivalent; 13C-NMR: Carbon-13 nuclear magnetic resonance; 1H-NMR: Proton nuclear magnetic resonance; VLC: Vacuum liquid chromatography; DMSO-d 6: Deuterated dimethyl sulfoxide; MHz: Megahertz; CC: Column chromatography; PC: Paper chromatography; CD: Czapek–Dox; PCR: Polymerase chain reaction; DNA: Deoxyribonucleic acid; CFU: Colony forming units; Mo: Molybdenum; S.D.: Standard deviation; SPSS: Statistical Package for the Social Sciences; BLAST: Basic local alignment tool.


   Introduction Top


Fungi, along with bacteria, protozoa, small invertebrates, and plants, play an essential and significant role in the soil ecosystem. Soil fungi were also considered as very important producers for secondary metabolites. Fungi produced several skeletally unique compounds that were used as pharmaceuticals.[1] Penicillium genus in addition to Aspergillus comprises a large group of anamorphic as comycetes fungal genus. This genus Penicillium is widespread in occurrence in terrestrial environments. Penicillium genus constitutes more than 200 known species and most of them are soil inhabitant as well as in food, cheese, and sausages.[2],[3] A wide range of bioactive secondary metabolites, including antibacterial, antifungal, immune suppressants, cholesterol-lowering agents, and mycotoxins were produced by Penicillium spp.[4] Secondary metabolites such as ergot alkaloids, diketopiperazines, quinolines, quinazolines, polyketides,[5] camazulene and azetidine,[6] viridicatol and kojic acid,[7] mycophenolic acid,[8] and compactins [9] are also known to be produced by Penicillium. Penicillium is also known to produce essential fatty acids and hydrocarbons and their therapeutically applications [10] by combating a number of human diseases.[11] Therefore, this research is undertaken with the aim of identifying locally isolated fungus and evaluates the in vitro antimicrobial activity of different vacuum liquid chromatography (VLC) fractions from extract of the fungus, Penicillium sp. SAM16-EGY, grown on rice medium. The chromatographic isolation and identification of its bioactive secondary metabolites were also studied.


   Materials and Methods Top


General experimental procedures

Proton nuclear magnetic resonance (1H-NMR) and carbon-13 nuclear magnetic resonance (13 C-NMR) spectra were recorded using Varian Mcauley (1 H, 400 and 13 C, 100 MHz), in deuterated dimethyl sulfoxide (DMSO-d 6). Melting point (uncorrected) was determined on an electrothermal apparatus. Sephadex LH-20 (25–100 μm, Pharmacia Fine Chemicals Inc., Uppsala, Sweden) was used for extra purification. Silica gel (70–230 mesh, Merck) was used for column chromatography (CC). Paper chromatography (PC) was carried out using Whatman No. 1 paper sheets (57 cm × 46 cm; Maidstone, England) and eluted via solvent systems S1 (n-BuOH: AcOH: H2O; 4:1:5 v/v/v; upper phase) and S2 (H2O: AcOH; 85:15 v/v).

Chemicals, media, and reagents

Nutrient agar medium (DSMZ1) composed of (g/l) beef extract (3), peptone (10), agar (18–20), and distilled water (1000 mL); Czapek–Dox (CD) agar medium (DSMZ 130) composed of the following composition (g/l): sucrose (30), NaNO3 (3), MgSO4.7H2O (0.5), FeSO4.7H2O (0.01), K2 HPO4 (1), KCl (0.5), distilled water (1000 mL), and agar (18–20) that were used for isolation (DSMZ30) and antimicrobial activity studies (DSMZ1 and DSMZ30).

Isolation of terrestrial fungi

Soil samples were collected in the surrounding of Mansoura Governorate, Egypt; during May 2012, soil was taken at 10 cm depth. Samples were sieved and air dried for 3–5 days at 28°C. After drying, samples were kept at 10°C until used. Fungal strains were isolated from soil samples. Enumeration of the microbes present in the soil was done by serial dilution-agar plating method. Serial dilution of soil suspension was prepared up to 10−6 dilution. Then, 0.1 mL of suspension from dilutions 10−3 to 10−6 was transferred to the  Petri dish More Detailses containing CD agar medium at 28°C ± 2°C for 6–8 days and growth was observed after 2 days. The fungi isolated on culture medium from soil were purified by spore suspension and streak method. The cultures were routinely (every 6–8 days) transferred onto fresh CD agar plates by streaking. Before fungal cultures were used for inoculation of rice medium, the fungus was subjected to three transfers on CD agar plates by the direct agar transfer method.[12]

Screening, scale-up fermentation, and extraction

Erlenmeyer flasks (1000 mL volume), each containing 50 g rice medium in 50 mL distilled water, were inoculated by the fungal spores. Each two conical flasks were inoculated with one fungal slant (10 days old) and incubated at 30°C under static condition for 15 days. Scale-up fermentation has to be maintained using 15 Erlenmeyer flasks (1 L volume) each contains 100 g rice and 100 mL distilled water, sterilized at 121°C (15 lb) for 20 min. Each flask was inoculated with spore suspension from 1 slant (10 days old). After incubation at 30°C for 15 days, the medium was extracted with ethyl acetate several times till exhaustion. A reddish brown extract was produced (18 g).

Fungal identification

Fungal isolate (SAM16) was identified by DNA isolation, amplification by polymerase chain reaction (PCR), and sequencing of the internal transcribed spacer (ITS) region. The primers ITS2 (GCTGCGTTCTTCATCGATGC) and ITS3 (GCATCGATGAAGAACGCAGC) were used at PCR while ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used at sequencing. The purification of the PCR products was carried to remove unincorporated PCR primers and dNTPs from PCR products using Montage PCR Clean-up kit (Millipore). Sequencing was performed by using Big Dye terminator cycle sequencing kit (Applied BioSystems, USA). Sequencing products were resolved on an Applied Biosystems model 3730XL automated DNA sequencing system (Applied BioSystems, USA). Candida sp. was used as control. The fungal strain (SAM16) culture was reserved in the Microbial Chemistry Department Culture Collection of Microorganisms.

Antimicrobial activity evaluation

The antimicrobial activities of different fractions as well as pure compounds isolated from Penicillium sp. SAM16-EGY that grown on rice medium have been evaluated by disc agar diffusion method.[13] Staphylococcus aureus ATCC 6538 (Gram-positive bacterium), Pseudomonas aeruginosa ATCC 25416 (Gram-negative bacterium), Candida albicans ATCC 10231 (yeast), and Aspergillus niger NRRL A-326 (fungus) were selected to estimate the antimicrobial activities. Bacteria and yeast test microbes were cultivated on a DSMZ1, whereas the fungal test microbe was cultivated on CD medium (DSMZ130). 1 mL of spore suspension (106–108 CFU/ml) each test microbe was used to inoculate 1 L-Erlenmeyer flask containing 250 mL of solidified agar media. These media were poured in previously sterilized Petri dishes (10 cm diameter having 25 mL of solidified media). Filter paper discs (5 mm Ø, Whatman No. 1 filter paper) loaded with 0.2 mg of each extract and/or 100 μg of pure sample were dried at room temperature under sterilized conditions and placed on the agar plates seeded with test microbes and incubated for 24 and 48 h for bacteria and fungi, respectively, at 37°C and 30°C. Antimicrobial activities were measured as the diameter of the clear zones that appeared around the discs.[14]

Determination of total antioxidant capacity using ascorbic acid as standard

The antioxidant activity was determined via phosphomolybdenum assay. Basically, this assay depends on the reduction of molybdenum (Mo [VI] to Mo (V) via the interaction with the tested sample and consequent creation of a green-colored (phosphate = Mo [V]) complex at acidic medium with a maximal absorption at 695 nm. Briefly, 0.5 ml from tested sample (100 μg/ml) in methanol was pooled in dry bottles with 5 ml of reagent (0.6 M sulfuric acid, 28 mM sodium phosphate, and 4 mM ammonium molybdate). The bottles were covered and incubated in water bath at 95°C for 90 min. After cooling, the absorbance was recorded at 695 nm against a blank (reagents and solvents without sample) under the same conditions. The antioxidant activity was expressed as the number of ascorbic acid equivalent (AAE), and all experiments were carried out in triplicate.[15]

Statistical analysis

All data were presented as mean ± standard deviation using SPSS 13.0 program (SPSS Inc., Chicago, IL, USA).

Isolation and purification of secondary metabolites

The ethyl acetate (EtOAc) extract was evaporated to dryness to give a brownish mass (15 g) and then undergone fractionation using VLC on silica gel 60 using solvents in a gradient of increasing polarity; n-hexane/ethyl acetate, dichloromethane/methanol (CH2 Cl2/MeOH), and 100% acetone step gradient elution to afford 13 fractions eluted from the VLC as follows; fractions 1–6 were eluted by n-hexane: EtOAc; 100:0–80:20–60:40–40:60–20:80–80:20–0:100 (%v/v), respectively; also, fractions 7–12 were eluted by CH2 Cl2:MeOH; 100:0–80:20–60:40–40:60–20:80–80:20–0:100 (%v/v) respectively; finally, fraction (13) was eluted by 100% acetone. Among them, fractions 4, 5, 6, and 9 were subjected to further purification using Sephadex LH-20 column (30 cm × 2 cm) eluted with 100% MeOH to afford five pure isolates. Briefly, fraction 4 (1.0 g) was subjected to Sephadex LH-20, eluted with gradient mix elution system; CH2 Cl2-MeOH till 100% MeOH to afford two compounds 1 and 2. However, fraction 5 (2.5 g) was subjected to silica gel CC., eluted with CH2 Cl2:MeOH via gradient mix elution system to afford two compounds 3 (CH2 Cl2:MeOH; 60:40, v/v) and 4 (CH2 Cl2:MeOH; 20:80, v/v). Fraction 6 (1.25 g) was subjected to Sephadex LH-20 eluted with 100% MeOH to afford compound 5. Finally, fraction 9 (2.0 g) was subjected to silica gel CC., eluted with CH2 Cl2:MeOH via gradient mix elution system to afford two compounds 6 and 7.


   Results and Discussion Top


Identification of the fungal isolate SAM16-EGY

The basic local alignment tool (BLAST) search for the DNA sequence (590 bp) of fungal isolate SAM16 revealed 99% similarity to Penicillium sp. strain 19 (acc. no.: KY401064.1). [Figure 1] shows the aligned sequence data of 18S ribosomal ribonucleic acid (18SrRNA) amplified from strain SAM16 while [Figure 2] shows the AB1 chromatogram of DNA sequencing of the isolate SAM16. The phylogenic tree of this fungal isolate was also constructed [Figure 3]. Based on the above identification techniques, our local soil fungal isolate was identified as Penicillium sp. SAM16-EGY with the GeneBank accession number KP125952 (http://www.ncbi.nlm.nih.gov/nuccore/KP125952). Traditional methods of fungal identification including the study of their morphology, growth on diverse media, kind of spores as well as biochemical performance such as production of pigments have been generally used, and several new species are identified according to these methods until now.[16] These old methods are considered as time-consuming, low sensitive, not easy to manage, and nonspecific.[16],[17] Targeting specific regions within the ribosomal RNA gene clusters using universal primers through PCR amplification is another selective method for the identification of fungi to the species level and also used for analyzing fungal variety.[18] In this work, ITS regions (ITS1–ITS5) of (rRNA gene clusters are used. Primers routinely used for the amplification of ITS regions of ribosomal DNA are ITS1 and ITS4.[19]
Figure 1: Aligned sequence data (590 bp) of 18S ribosomal ribonucleic acid amplified from strain SAM16

Click here to view
Figure 2: AB1 chromatogram of DNA sequencing of the isolate SAM16

Click here to view
Figure 3: Phylogenetic tree showing relationship of strain SAM16 with other related fungal species retrieved from GenBank based on their sequence homologies of 18S ribosomal ribonucleic acid

Click here to view


The antimicrobial activity of different vacuum liquid chromatography fractions from the ethyl acetate extract of Penicillium sp. SAM16-EGY against different groups of test microbes

The ethyl acetate extract from Penicillium sp. SAM16-EGY, grown on rice medium, was fractionated via VLC into 13 fractions and these fractions were subjected to in vitro antimicrobial activity test against four test micro-organisms, i.e., S. aureus (Gram-positive bacterium), Pseudomonas aeruginosa (Gram-negative bacterium), C. albicans (yeast), and Aspergillus niger (fungus). Results postulated in [Table 1] revealed the antimicrobial activity of the VLC fractions. It has been found that fractions 4, 5, and 6 showed considerable activity against all test microbes except the fungus, A. niger. Fraction 5 showed almost the highest antimicrobial activity against C. albicans (14.5 mm), S. aureus (10 mm) and P. aeruginosa (10 mm). On the other hand, fractions 9 and 10 exhibited weak activity against P. aeruginosa (6/6 mm), C. albicans (6/6 mm), and A. niger (6/6 mm), and no antimicrobial activity was noticed with S. aureus. Penicillium species are known with their antimicrobial potentials.[20],[21],[22] The antimicrobial activity of the methanolic extract of Penicillium species isolated from Iranian agricultural soil was evaluated against five microbial strains including; C. albicans, Bacillus subtilis, S. aureus,  Salmonella More Details typhi, and  Escherichia More Details coli with inhibition zones were ranged from 10 to 30 mm.[21] Moreover, Shaaban et al. have been reported on the antimicrobial activity of the crud extract of the terrestrial fungus Penicillium sp. KH Link 1809 against five microbial strains, i.e., B. subtilis (27 mm), S. aureus (26 mm), P. aeruginosa (31 mm), and C. albicans (25 mm), and there is no activity was recorded against A. niger.[7]
Table 1: The antimicrobial activity of different vacuum liquid chromatography fractions from the ethyl acetate extract of Penicillium spp. SAM16-EGY against different groups of test microbes

Click here to view


Structural elucidation of the isolated compounds

The promising antimicrobial fractions resulted from VLC were undergo further purification to afford seven compounds were identified on the basis of their one-dimensional (1 H and 13 C-NMR analyses). The chemical structures of the isolated compounds were illustrated in [Figure 4].
Figure 4: Chemical structures of the isolated compounds

Click here to view


Compound 1 was isolated as a yellow powder, Rf: 0.88 (S1, PC). The 1 H and 13 C-NMR spectral data indicated that compound 1 belong to polyoxygenated cyclohexane, it was similar to those known compounds rotepoxide A,[23] and 3-debenzoylrotepoxide A, which previously isolated from Kaemphera rotunda L.,[24] except the presence of long alcoholic chain at position 3. Complete assignments of all protons and carbons are summarized in [Table 2].1H-NMR showed a characteristic signal for benzoate moiety at δH7.45–7.48 ppm (5H, m, H-2'-6') which confirmed by aromatic carbons signals in 13 C spectra at δC130.17 (C-1'), 129.09 (C-2', 6'), 128.19 (C-3', 5'), 132.18 (C-4').[25] 1H-NMR spectra showed an AB quartet at δH3.91 and 4.38 ppm was attributed to oxy-methylene protons (2H, q, H2-7) and at δc 65.93 (C-7). Moreover, it showed two doublets resonated at δH3.91 and 5.08 ppm (d, J = 3.0 Hz) were assigned to H-2 and H-6, respectively, and three doublet of doublet signals at δH3.89 (dd, H-3), 3.91 (dd, H-4) and 4.61 (dd, H-5).1H-NMR spectra showed presence of long chain alcohol residue which observed at δH4.38 (2H, t, H2-1'), 1.7 (4H, m, H2-2' and 3'), 1.0 (32 H, brs, H-4.-21'), and terminal methyl at δH0.62 (3H, t, J = 6 Hz, Me-22').[26] Thirty-six carbon atoms were observed in the 13 C-NMR spectra which were classified as; two quaternaries at δC63.53 (C-1) and 130.17 (C-1'), five oxygenated methines at δC67.84 (C-2), 74.0 (C-3), 63.08 (C-4), 69.75 (C-5), and 61.0 (C-6), carbonyl carbon at δC167.43 ppm in addition to six aromatic carbons. 21 methylene carbons (C-1'' to C-21'') belong to long alcoholic chain showed signals at δC31.26–22.85 ppm and one methyl carbon at δC14.31 ppm.[27] According to the above-mentioned data, compound 1 was identified as 3-O-docosyl-1-benzoyloxy methyl-6-epoxy-cyclohexane-2, 3, 4, 5 tetrol.
Table 2: Proton and carbon-13 nuclear magnetic resonance spectral data (400/100 MHz-DMSO-d6) of compounds 1 and 2

Click here to view


Compound 2 was isolated as a yellow powder, Rf: 0.86 (S1, PC),1H-NMR spectra [Table 2] exhibited a characteristic signal for aromatic ring, it showed signals at δH6.87 (d, J = 9.0 Hz, H-2), 6.66 (d, J = 9.0 Hz, H-3), indicating AB system similar to those of a 1,4 hydroquinone moieties.[28] It also showed signals at δH7.34 (dd, J = 6.0, 3.0 Hz, H-8), 7.0 (J = 12.0 Hz, H-6), and 6.47 (dd, J = 12.0, 6.0 Hz, H-7), which related to coupling system of olefinic protons, there are signals at δH6.17 (d, J = 8.0 Hz, H-10) and at δH1.71 (d, J = 8.0 Hz, H-9a) which associated with methines, one of which corresponding to oxymethine proton. Also, a characteristic signal for methyl group was recorded at δH1.24 ppm. 13 C-NMR spectrum [Table 2] displayed signals for 16 carbon atoms, 13 of which corresponding to sp2 hybridized carbons; it showed aromatic carbon signals at δC149.88 (C-1), 120.64 (C-2), 117.0 (C-3), 147.6 (C-4), 135.56 (C-4a), and 127.0 (C-10a), one methine carbon at δC48.33 (C-9a), oxymethine at δC61.24 (C-10), and methyl group at δC16.78 ppm. Moreover,13 C-NMR revealed five monohydrogenated and eight nonhydrogenated carbon atoms; one characteristic carbon of γ-lactone carboxyl at δC169.49 (C-12), oxygenated carbon at δC149.88 (C-1), and oxygenated carbons of 1,4-hydroquinone at δC147.0 (C-4); these spectral data confirmed its type-like structure as monoterpenoid hydroquinone which by comparison with literature data; compound 2 was previously isolated from Cordia globosa and identified as (4bE, 6Z, 8E, 9aS, 10S)-1,4-dihydroxy-9a, 10-dihydro-10,12-epoxy-5-methylbenzo[a] azulen-12-one.[28]

Compound 3 was isolated as white fine crystal, Rf: 0.76 (CHCl3: MeOH: H2O; 7: 3: 0.5, v/v/v, TLC).1 H-NMR showed [Table 3] the presence of eight methyl signals at δH0.87 (3H, s, H-18), 0.88 (3H, s, H-19), 0.90 (3H, d, J = 5 Hz, H-16), 0.91 (3H, s 7-OAc), 1.24 (3H, d, J = 8 Hz, H-20), 1.71 (3H, s, H-17), 1.80 (3H, s, 9-OAc), and 2.09 (3H, s, 15-OAc) ppm. Five aromatic protons were resonated at δH7.48 (2H, d, J = 9 Hz, H-2' and H-6'), 7.69 (2H, m), and 7.13 (H, d, J = 6 Hz, H-4'). Three olefinic protons showed signals at δH6.15 (H, d, J = 10 Hz, H-5), 5.95 (H, d, J = 15 Hz, H-11), and 5.15 (H, d, J = 15 Hz, H-12).13 C-NMR spectra [Table 3] exhibited 33 carbon resonances including four carbonyl, one benzoyl carbonyl resonated at δC174.40 (Bz C = O), and three acetate carbonyl at δC172.74, 169.82, and 166.83 ppm. In addition, to the presence of different type of resonating carbons including five methyls at δC11.26 (C-16), 14.35 (C-17), 16.11 (C-18), 20.15 (C-19), and at 22.5 (C-20), two methylene resonated at δC40.36 (C-1) and 30.25 (C-8), ten methines at δC39.7 (C-2), 83.0 (C-3), 49.06 (C-4), 67.88 (C-7, C-9), 40.06 (C-13), and 84.0 (C-14) including three olefinic at δC124.0 (C-5), 132.18 (C-11), and 132,06 (C-12) in addition to three quaternary carbons at δC132.8 (C-6), 40.16 (C-10), and 90.0 (C-15). According to the above data and comparison to published literature, compound 3 was identified as 7α, 9β, 15β-triacetoxy-3-β-hydroxy jatropha-5E, 11E-diene (Jatrophane diterpenoid), which was previously isolated from Euphorbia helioscopia.[29]
Table 3: Proton and carbon-13 nuclear magnetic resonance spectral data (400/100 MHz-DMSO-d6) of compounds 3 and 4

Click here to view


Compound 4 was isolated as white amorphous, Rf: 0.58 (CHCl3: MeOH: H2O; 7: 3: 0.5, v/v/v, TLC).1 H-NMR spectra [Table 3] showed two anomeric protons corresponding to two glucose moieties were resonated at δH4.31 (d, J = 8.5 Hz) and 5.50 (d, J = 7.8 Hz) as two doublet which supported and anchored two hexose moieties supported by two anomeric carbons at δC105.0 and 96.7 ppm. Three methyls singlet signals were resonated at δH0.9 (3H, s, Me-13), 1.22 (3H, s, Me-14), and 1.86 (3H, s, Me-15).1 H-NMR spectra showed resonance of six methylene groups, two oxygenated methylens at δHC4.22 (2H, brs, H2-12)/70.0 and at δHC3.99 (2H, d, J = 4.0 Hz, H2-1)/66.01, respectively; two singlet methylens were resonated at δH2.00 (2H, s, H2-9) and 2.27 (2H, s, H2-29 malonate methylene) and two methylens were resonated at δH2.51 (2H, d, J = 0.4 Hz, H2-3) and 2.42 (2H, m, H2-2).13 C-NMR showed 30 carbon atoms including three carbonyl groups were resonated at δC171.43, 165.35, and 183.55 ppm of malonate moieties, 12 carbon of two hexose sugars, 15 carbons of terpene core, and three of malonate moieties [Table 3]. Comparison with literature spectral data, compound 4 showed data similar to that previously isolated from Solanum habrocnaites[30] and identified as Sesquiterpene I diol dihexoside malonate ester.

Compound 5 was isolated as pale yellow fine crystals, Rf: 0.62 (S2, PC).13 C-NMR spectra suggesting the presence of aromatic moiety showed signals in the range of 153.40–135.0 ppm;1 H-NMR spectra [Table 4] showed singlet of aromatic methyl at δH2.01 (3H, s, Me-7), δC10.43 (Me-7).13 C-NMR also showed that the presence of conjugated carbonyl groups deduced from two signals at δC187.70 and 176.45 ppm indicate the presence of a quinone moiety.1 H and 13 CNMR spectra showed characteristic signals of prenyl moieties as methylene group at δH3.17 (2H, d, J = 6 Hz, H2-1”) δC27.6, ethylene proton was appeared at δH4.13 (H, m, H-2”) and δC122.0, 131.94 (C-2''and 3''), and two methyls were resonated at δH1.24 (3H, brs, H3-4”) and δC23.00 (Me-4'') and δH1.29 (3H, brs, H3-5”) and δC21.70 (Me-5'');[31] they also showed characteristic signals of geranyl moiety, two ethylene protons at δH5.72 (H, t, H-2') and δC114.75, 135.0 (C-2' and C-3') and δH6.2 (H, m, H-6') and δC128.64, 131.94 (C-6'and C-7'), methylene protons were resonated at δHC3.3 (2H, d, J = 7 Hz, H2-1')/21.74 and 1.29 (2H, t, J = 7 Hz, H2-4')/40.4 and 2.25 (2H, m, H2-5')/27.68. Two methyls were resonated at δHC0.87 (3H, brs, H3-9')/13.74 (Me-9') and 0.88 (3H, brs, H3-10')/15.0 (Me-10').[32] The absence of aromatic protons indicated that quinone nucleus is completely substituted by two alkenyl moieties, geranyl and prenyl chains, and methyl and hydroxyl groups. Comparison with literature, spectral data of compound 5 was identified as Piperogalone, which was previously isolated from Peperomia galioides.[33]
Table 4: Proton and carbon-13 nuclear magnetic resonance spectral data (400/100 MHz-DMSO-d6) of compounds 5, 6, and 7

Click here to view


Compound 6 isolated as colorless oil.1 H- and 13 C-NMR spectrum of compound 6 [Table 4] showed characteristic signals of long chain of an unsaturated aliphatic compound, it showed a triplet signal at δH0.85 (6H, t, J = 4.0 Hz, Me-14) indicative to terminal methyl supported by signal at δC14.34, and it also showed methylene signals at δH1.17-1.24 (brs) and at δH1.4 (brs) indicative of chain of methylene groups confirmed by signals at δC31.1-22.53. Four olefinic protons appeared as four multiples at δH5.7, 6.5, 7.00 and 7.11 (4H, m, H-8,-9,-11 and-12) as well as at δC126.51 (C-8), 129.12 (C-9), 127.14 (C-11), and 132.08 (C-12). In addition to two oxymethine protons, it showed signals at δH72.89 and 72.38 (C-6 and C-5).1 H and 13 C-NMR spectrum data indicated presence of sugar moiety at δH4.27 (H, d, J = 8.0 Hz, anomeric H-1') and at δC97.31 (anomeric carbon). Terminal carboxylic carbon gave signal at δC177.64 (C-1), in addition to two carbonyl of malonyl moiety at δC174.89 and 171.49 ppm. The previous data show similarities to C-14 oxylipin glucosides isolated from Lemna paucicostata. Therefore, according to these data compound 6 can identified as (5R, 8Z, 11Z)-5 β-(6'-O-malonyl-β-glucopyranozyloxy-6-hydroxy tetradeca-8, 11-dienoic acid.[34]

Compound 7 is a colorless crystal, melting point 79°C – 80°C. Both 1 H-NMR and 13 C-NMR spectral data [Table 4] of this compound characteristic features of unsaturated long chain aliphatic compounds.13 C-NMR displayed signals for ester carbon at δC167.46 (C-1), two vinylic carbon at δC132.16 (C-9) and 129.09 (C-10), oxygenated methylene at δC67.85 (C-1''). The other methylene groups carbon appears in the range of δC31.61–22.48 ppm and two terminal methyl showed signal at δC14.30 (C-18) and 11.21 (C-25').1 H-NMR spectrum showed multiplet at δH5.0-5.45 assigned to vinyl H-9 and H-10, two triplets at δH3.99 was ascribed to oxygenated methylene (2H, t, J = 8.0 and4.0 Hz, H-1') and at δH2.26 (2H, m, H2-11). It showed two terminal methyl signals at δH0.89 (3H, t, J = 4.0 Hz, Me-18) and 0.63 (3H, t, J = 4.0 Hz, Me-23'). Compound 7 was previously isolated from Albizzia lebbeck and Cuminum cyminum. On the basis of the above data, compound 7 was identified as n-trcosanyl-n-octaced-9-enoate.[35],[36],[37]

In vitro antimicrobial activity of the isolated compounds 1–7

Seven compounds were isolated from ethyl acetate extract of Penicillium sp. SAM16-EGY; these compounds were subjected to in vitro antimicrobial activity test against four pathogenic microbial strains, i.e., S. aureus (G-positive bacterium), P. aeruginosa (Gram-negative bacterium), C. albicans (yeast), and A. niger (fungus). Results postulated in [Table 5] and [Figure 5] revealed the antimicrobial activity of these compounds. It has been found that compounds 1, 2, 4, and 5 showed a noticeable activity against all test microbes except the fungus, A. niger. However, compound 3 showed almost the highest antimicrobial activity against C. albicans (11 mm), S. aureus (9 mm), P. aeruginosa (9 mm), and A. niger (13 mm). From the obtained data, it is clear that compound 3 (Jatrophane diterpenoid) possess higher antifungal activity against A. niger and no antifungal activities were recorded with the rest of the tested compounds. Our findings are in agreement with the study done by El-Bassuony, who reported on the antibacterial activity of two Jatrophane diterpenoids against Gram-positive bacteria Bacillus cereus (11 mm) and S. aureus (6 mm).[38]
Table 5: Antimicrobial activity of pure isolated compounds (1–7) from the ethyl acetate extract of Penicillium spp. SAM16-EGY against different groups of test microbes

Click here to view
Figure 5: In vitro antimicrobial activities of the isolated compounds against four pathogenic microbes

Click here to view


Total antioxidant capacity of different vacuum liquid chromatography fractions and isolated compounds

Oxidative stress is considered a great health issue leading to several health disorders. This phenomenon is due to an overproduction of free radicals and consequent accumulation of reactive species. Several studies have demonstrated that natural compounds derived from both medicinal plants or fungal extracts have a great ability to eliminate hazards of such reactive species and thus are considered promising naturally occurring antioxidant agents.[39],[40],[41],[42]

In the present study, 13 fractions resulting from VLC of the ethyl acetate extract of Penicillium sp. SAM16-EGY and seven isolated compounds were investigated for their total antioxidant capacities using phosphomolybdenum method. In phosphomolybdenum assay, total antioxidant capacity (TAC) values for the tested fractions were ranged from 212.53 to 687.56 mg AAE/g fraction. Fraction 3 showed the highest TAC of 687.56, while fraction 9 showed the lowest TAC of 212.53 mg AAE/g fraction [Table 6]. On the other hand, the TAC values for the tested compounds were ranged from 332.16 to 608.59 mg AAE/g compound. The results are in the order: Compound 5 > 2 > 1, and no any activities were detected with compounds 3, 4, 6, and 7 [Table 7]. Penicillium species are known by their numerous biological activities;[43],[44] among them is the antioxidant potential. These species have arisen as the new sources of naturally occurring antioxidant secondary metabolites.[45],[46] Hulikere et al. reported on the antioxidant activity of the ethyl acetate extract of Penicillium citrinum, which may be returned to the presence of certain phenolic compounds in such extract.[47] In this context, the TAC of ethyl acetate extract of Penicillium sp. was evaluated via phosphomolybdenum method and the results revealed that it has antioxidant capacity of 325.76 mg equivalent to ascorbic acid. Moreover, Yuan et al. reported on the free radical scavenging activity of adenosine isolated from Penicillium sp. YY-20.[48] Accordingly, the current study implies that the Penicillium sp. could be used as a vital source of natural antioxidant agents.
Table 6: Total antioxidant capacity values of different vacuum liquid chromatography fractions

Click here to view
Table 7: Total antioxidant capacity values of the isolated compounds

Click here to view



   Conclusion Top


Soil-inhabiting fungi were considered as a prolific source for the isolation of several bioactive secondary metabolites. Fungi isolating from soil were identified by the molecular techniques (18SrRNA) because these techniques surpass the manual one in their accuracy and saving time. VLC was used as a fast system for fractionating the extract. The fractions which exhibit antimicrobial activities were selected for furtherer studies including isolation, purification, and structure elucidation of the pure compounds obtained. The antimicrobial and antioxidant activities of the produced compounds were also studied. The continuous work in that field could result in the discovery of new compounds with unexpected biological activity.

Acknowledgement

This work was financially supported by the Commission of Research Projects-Theodor Bilharz Research Institute (No. 103A).

Financial support and sponsorship

This work was financially supported by the Commission of Research Projects-Theodor Bilharz Research Institute (No. 103A).

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Adrio JL, Demain AL. Fungal biotechnology. Int Microbiol 2003;6:191-9.  Back to cited text no. 1
    
2.
Pitt JI. A Laboratory Guide to Common Penicillium Species. 3rd ed. Australia: Food Science Australia Publishers; 2000. p. 197.  Back to cited text no. 2
    
3.
Frisavd JC, Samson RA. Polyphasic taxonomy of Penicillium subgenus Penicillium: A guide to identification of food and air-borne terverticillate penicillia and their mycotoxins. Stud Mycol 2004;49:1-74.  Back to cited text no. 3
    
4.
Petit P, Lucas EM, Abreu LM, Pfenning LH, Takahashi JA. Novel antimicrobial secondary metabolites from a Penicillium sp. isolated from Brazilian Cerrado soil. Electron J Biotechnol 2009;12:8-9.  Back to cited text no. 4
    
5.
Kozlovskiĭ AG, Zhelifonova VP, Antipova TV. Fungi of the genus Penicillium as producers of physiologically active compounds (review). Prikl Biokhim Mikrobiol 2013;49:5-16.  Back to cited text no. 5
    
6.
Kwon OE, Rho MC, Song HY, Lee SW, Chung MY, Lee JH, et al. Phenylpyropene A and B, new inhibitors of acyl-CoA: Cholesterol acyltransferase produced by Penicillium griseofulvum F1959. J Antibiot (Tokyo) 2002;55:1004-8.  Back to cited text no. 6
    
7.
Shaaban M, Sohsah GE, El-Metwally MM, Elfedawy MG, Abdel-Mogib M. Bioactive compounds produced by strain of Penicillium sp. Int J Sci Eng Appl 2016;5:342-7.  Back to cited text no. 7
    
8.
Bentley R. Mycophenolic acid: A one hundred year odyssey from antibiotic to immunosuppressant. Chem Rev 2000;100:3801-26.  Back to cited text no. 8
    
9.
Frisvad JC, Filtenborg O. Terverticillate penicillia: Chemotaxonomy and mycotoxin production. Mycologia 1989;81:837-61.  Back to cited text no. 9
    
10.
Lucas EM, Castro MC, Takahashi JA. Antimicrobial properties of sclerotiorin, isochromophilone VI and pencolide, metabolites from a Brazilian cerrado isolate of Penicillium sclerotiorum VanBeyma. Braz J Microbiol 2007;38:785-9.  Back to cited text no. 10
    
11.
Liu CH, Mishra AK, He B, Tan RX. Composition and antifungal activity of essential oils from Artemisia princeps and Cinnamomum camphora. Int Pest Control 2001;43:72-4.  Back to cited text no. 11
    
12.
Abdel-Aziz MS, Ghareeb MA, Saad AM, Refahy LA, Hamed AA. Chromatographic isolation and structural elucidation of secondary metabolites from the soil-inhabiting fungus Aspergillus fumigatus 3T-EGY. Acta Chromatogr 2018;30:243-9.  Back to cited text no. 12
    
13.
El-Neekety AA, Abdel-Aziz MS, Hathout AS, Hamed AA, Sabry BA, Ghareeb MA, et al. Molecular identification of newly isolated non-toxigenic fungal strains having antiaflatoxigenic, antimicrobial and antioxidant activities. Der Pharm Chem 2016;8:121-34.  Back to cited text no. 13
    
14.
Hathout A, El-Nekeety A, Hamed A, Sabry B, Abdel-Aziz M, Ghareeb M, et al. Novel Egyptian bacterial strains exhibiting antimicrobial and antiaflatoxigenic activity. J Appl Pharm Sci 2016;6:1-10.  Back to cited text no. 14
    
15.
Ghareeb MA, Saad AM, Abdou AM, Refahy LA, Ahmed WS. A new kaempferol glycoside with antioxidant activity from Chenopodium ambrosioides growing in Egypt. Orient J Chem 2016;32:3053-61.  Back to cited text no. 15
    
16.
Zhao J, Kong F, Li R, Wang X, Wan Z, Wang D, et al. Identification of Aspergillus fumigatus and related species by nested PCR targeting ribosomal DNA internal transcribed spacer regions. J Clin Microbiol 2001;39:2261-6.  Back to cited text no. 16
    
17.
Raper KB, Fennell DI. The Genus Aspergillus. Baltimore, Washington: Williams and Williams; 1965.  Back to cited text no. 17
    
18.
Chen YC, Eisner JD, Kattar MM, Rassoulian-Barrett SL, Lafe K, Bui U, et al. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J Clin Microbiol 2001;39:4042-51.  Back to cited text no. 18
    
19.
White NA, Dehal PK, Duncan JM, Williams NA, Gartland JS, Palfreyman JW, et al. Molecular analysis of intraspecific variation between building and wild isolates of Serpula lacrymans and their relatedness to S. himantioides. Mycol Res 2001;105:447-52.  Back to cited text no. 19
    
20.
Devi P, Rodrigues C, Naik CG, D'Souza L. Isolation and characterization of antibacterial compound from a mangrove-endophytic fungus, Penicillium chrysogenum MTCC 5108. Indian J Microbiol 2012;52:617-23.  Back to cited text no. 20
    
21.
Gharaei-Fathabad E, Tajick-Ghanbary MA, Shahrokhi N. Antimicrobial properties of Penicillium species isolated from agricultural soils of Northern Iran. Res J Toxins 2014;6:1-7.  Back to cited text no. 21
    
22.
Elkhayat ES, Goda AM. Antifungal and cytotoxic constituents from the endophytic fungus Penicillium sp. Bull Fac Pharm Cairo Univ 2017;55:85-9.  Back to cited text no. 22
    
23.
Stevenson PC, Veitch NC, Simmonds MS. Polyoxygenated cyclohexane derivatives and other constituents from Kaempferia rotunda L. Phytochemistry 2007;68:1579-86.  Back to cited text no. 23
    
24.
Feng AS. Chemical Constituents and Bioactivity of Malaysian and Indonesian Kaempferia rotunda, M. Sc. Thesis, Faculty of Science, University of Teknologi, Malaysia; 2009.  Back to cited text no. 24
    
25.
Velasco BR, Gil GJ, Garcia PC, Durango RD. Production of 2-phenyl ethanol in the biotransformation of cinnamoyl alcohol by the plant pathogenic fungus Colletotrichum acutatum. Rev Fac Quim Farm 2010;17:272-80.  Back to cited text no. 25
    
26.
Suifeng Y. Chemical Constituents and Bioactivity of Malaysian and Indonesian Kaempheria rotunda. MSc. Thesis. Faculty of Science, University of Malaysia; 2009.  Back to cited text no. 26
    
27.
Balde AM, Claeys M, Pieters LA, Wray V, Vlietink AJ. Ferulic acid esters from stem bark of Pavetta owariensis. Phytochemistry 1991;30:1024-6.  Back to cited text no. 27
    
28.
Silva AK, de Oliveira AL, Pinto FD, de Lima KS, Braz-Filho R, Silveira ER, et al. Meroterpenoid hydroquinones from Cordia globosa. J Braz Chem Soc 2016;27:510-4.  Back to cited text no. 28
    
29.
Hua J, Liu YC, Jing SX, Luo SH, Li SH. Macrocyclic diterpenoids from the latex of Euphorbia helioscopia. Nat Prod Commun 2015;10:2037-9.  Back to cited text no. 29
    
30.
Eknoayaka EA. Analytical Strategies for Profiling, Annotation and Structure Elucidation of Specialized Terpenoid Metabolites. Ph.D. Thesis, Michigan State University; 2014.  Back to cited text no. 30
    
31.
Aminah NS, Kristanti AN, Tanjung M. Antioxidant activity of flavonoid compounds from the leaves of Macaranga gigantea. J Chem Pharm Res 2014;6:688-92.  Back to cited text no. 31
    
32.
Smejkal K, Grycová L, Marek R, Lemière F, Jankovská D, Forejtníková H, et al. C-geranyl compounds from Paulownia tomentosa fruits. J Nat Prod 2007;70:1244-8.  Back to cited text no. 32
    
33.
Mahiou V, Roblot F, Hocquemiller R, Cavé A, Rojas De Arias A, Inchausti A, et al. New prenylated quinones from Peperomia galioides. J Nat Prod 1996;59:694-7.  Back to cited text no. 33
    
34.
Kai K, Akaike R, Iida K, Yokoyama M, Watanabe N. C14-oxylipin glucosides isolated from Lemna paucicostata. Phytochemistry 2010;71:1168-73.  Back to cited text no. 34
    
35.
Alam P, Ali M, Aeri V. Isolation of a new keto steroid stigmast-4,20 (21), 23-trien -3-one and a new alcohol tricontan-10-α-ol from the root of Albizzia lebbeck benth. J Nat Prod Plant Reour 2012;2:234-8.  Back to cited text no. 35
    
36.
Chaudary N, Husain SS, Ali M. New phenolic triterpenic and steroids constituents from the fruits of Cuminum cyminum L. J Pharmacog Phytochem 2014;3:149-54.  Back to cited text no. 36
    
37.
Aeri V, Alam P, Ali M, Naquri KJ. A new phytosteroid and aliphatic constituents from the roots of Albizzia lebbeck Benth. J Pharm Chem Biol 2015;3:432-9.  Back to cited text no. 37
    
38.
El-Bassuony AA. Antibacterial activity of new polyester diterpenes from Euphorbia guyoniana. Asian J Chem 2007;19:4553-62.  Back to cited text no. 38
    
39.
Ghareeb MA, Mohamed T, Saad AM, Refahy LA, Sobeh M, Wink M, et al. HPLC-DAD-ESI-MS/MS analysis of fruits from Firmiana simplex (L.) and evaluation of their antioxidant and antigenotoxic properties. J Pharm Pharmacol 2018;70:133-42.  Back to cited text no. 39
    
40.
Sobeh M, Mahmoud MF, Hasan RA, Abdelfattah MA, Sabry OM, Ghareeb MA, et al. Tannin-rich extracts from Lannea stuhlmannii and Lannea humilis (Anacardiaceae) exhibit hepatoprotective activities in vivo via enhancement of the anti-apoptotic protein bcl-2. Sci Rep 2018;8:9343.  Back to cited text no. 40
    
41.
Ghareeb M, Saad A, Ahmed W, Refahy L, Nasr S. HPLC-DAD-ESI-MS/MS characterization of bioactive secondary metabolites from Strelitzia nicolai leaf extracts and their antioxidant and anticancer activities in vitro. Pharmacogn Res 2018;10:368-78.  Back to cited text no. 41
    
42.
Ghareeb MA, Sobeh M, Rezq S, El-Shazly AM, Mahmoud MF, Wink M. HPLC-ESI-MS/MS profiling of polyphenolics of a leaf extract from Alpinia zerumbet (Zingiberaceae) and its anti-Inflammatory, anti-nociceptive, and antipyretic activities in vivo. Molecules 2018;23:32-8.  Back to cited text no. 42
    
43.
Stierle AA, Stierle DB. Bioactive compounds from four endophytic Penicillium sp. of Northwest Pacific yew tree. Atta-ur-Rahman (Ed.). Stud Nat Prod Chem 2000;24:933-77.  Back to cited text no. 43
    
44.
Devi NN, Prabakaran JJ. Bioactive metabolites from an endophytic fungus Penicillium sp. isolated from Centella asiatica. Curr Res Environ Appl Mycol 2014;4:34-43.  Back to cited text no. 44
    
45.
El-Sayed OH, Asker MM, Shash SM, Hamed SR. Isolation, structure elucidation and biological activity of di- (2-ethylhexyl) phthalate produced by Penicillium janthinellum 62. Int J Chem Tech Res 2015;8:58-66.  Back to cited text no. 45
    
46.
Subha K, Baskar V, Kanimozhi K, Panneerselvam A. In vitro investigation on antioxidant activity of terrestrial and marine Penicillium chrysogenum strains. Int J Res Pure Appl Microbiol 2015;5:1-5.  Back to cited text no. 46
    
47.
Hulikere MM, Joshi CG, Nivya T, Ananda D, Raju NG. Antiangiogenic and antioxidant activity of endophytic fungus isolated from seaweed (Sargassum wightii). Asian J Biochem 2016;11:168-76.  Back to cited text no. 47
    
48.
Yuan Y, Tian JM, Xiao J, Shao Q, Gao JM. Bioactive metabolites isolated from Penicillium sp. YY-20, the endophytic fungus from Ginkgo Biloba. Nat Prod Res 2014;28:278-81.  Back to cited text no. 48
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6], [Table 7]



 

Top
  
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and Me...
    Results and Disc...
   Conclusion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed153    
    Printed9    
    Emailed0    
    PDF Downloaded0    
    Comments [Add]    

Recommend this journal