Home | About PR | Editorial board | Search | Ahead of print | Current Issue | Archives | Instructions | Subscribe | Advertise | Contact us |   Login 
Pharmacognosy Magazine
Search Article 
  
Advanced search 
 


 
RESEARCH ARTICLE
Year : 2009  |  Volume : 1  |  Issue : 6  |  Page : 421-427 Table of Contents     

Molluscicidal activity against Oncomelania hupensis of endophyte JJ18 from Pseudolarix kaempferi Gord


1 College of Pharmacy, Jiangsu University, Zhenjiang, Jiangsu, China
2 College of Pharmacy, Jiangsu University, Zhenjiang, Jiangsu; Research Center of Plant Cell Engineering, West Anhui University, Lu’an, Anhui, China
3 School of Food & Bioengineering, Henan University of Science and Technology, Luoyang, China
4 Zhenjiang Institute of Parasitic Diseases, Zhenjiang, Jiangsu, China

Date of Web Publication2-Jan-2010

Correspondence Address:
Jun Chen
College of Pharmacy, Jiangsu University, Zhenjiang, Jiangsu
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


Rights and PermissionsRights and Permissions
   Abstract 

To screen a kind of biological controlling measure against the Oncomelania hupensis snails, This study is to research the molluscicidal effect of JJ18 and identify its species. The alcoholic extract of JJ18 broth effectively killed O. hupensis snails, and the n-butanol fraction of the extract had the best molluscicidal activity compared with other fractions. Ochratoxin A was detected from JJ18 broth with ELISA analysis, and it may be a molluscicidal active substance in the broth. JJ18 strain belongs to Aspergillus niger was identified by morphology characteristics of the slide culture and rDNA ITS sequence analyzing.

Keywords: Oncomelania hupensis; Endophyte; molluscicidal activity; Pseudolarix kaempferi Gord; ITS sequence.


How to cite this article:
Chen J, Han Bx, Guo Sb, Wang Y, He J, Zhou Xk, Yang X, Han Fa. Molluscicidal activity against Oncomelania hupensis of endophyte JJ18 from Pseudolarix kaempferi Gord. Phcog Res 2009;1:421-7

How to cite this URL:
Chen J, Han Bx, Guo Sb, Wang Y, He J, Zhou Xk, Yang X, Han Fa. Molluscicidal activity against Oncomelania hupensis of endophyte JJ18 from Pseudolarix kaempferi Gord. Phcog Res [serial online] 2009 [cited 2019 Aug 24];1:421-7. Available from: http://www.phcogres.com/text.asp?2009/1/6/421/58035


   Introduction Top


Schistosomiasis is one of the most widespread human parasite diseases in the world. In China, as well as in several African, the Caribbean, the Middle East, and South American countries, the disease continues to be a major public health problem. Integrated schistosomiasis control programs were recommended by WHO [1] , and the intermediate host snail control is an important preventive strategy associated with treatment of infected people, together with environmental and socio-economic improvements and health education with community participation. Although chemical molluscicides are the most useful approach for the snail control, the majority of studies have demonstrated rapid re-colonization of the transmission sites by the intermediate hosts. Oncomelannia hupensis is the only intermediate host of Schistosoma japonicun Katsurade [2] , and is the most fragile during its life cycle, and one way to resolve the problem of Schistosoma is to destroy the carrier snails and break the life cycle of the parasite, thus it is an essential practice to destroy snails of O. hupensis. The treatment with molluscicides of water masses serving as transmission sites is considered an important element in an integrated strategy for the control of the disease. At present, only one synthetic molluscicide (niclosamide) is recommended for schistosomiasis control, but it is expensive and the cost involved in the large-scale use of this compound is prohibitive for most of the developing countries concerned. However, together with concerns about their toxicity to non-target organisms and the possible development of snail resistance, it has lead to a demand for cheaper alternatives [3],[4] . To find a safe and low-cost alternative, miscellaneous resources should be screened for molluscicidal activity.

Since the 1930s, the molluscicidal properties of numerous plant extracts have been studied, especially the novel plant species that exhibit molluscicidal activity are greatly facilitated by consideration of traditional folk medicine or the ethnopharmacological literature for use by local communities in the control of the snail vector [5] . Endophytic microorganisms exist within the living tissues of most plant species. They are most abundant in medicinal plants. Novel endophytes usually have associated with them novel secondary natural products and/or processes [6],[7] . On the other side, the molluscicidal effect of plant allelopathy is recognized and established [8] , many researchers focus on chemical constituents of plants to explain the allelopathy effect [9] , but its mechanism is not clear till now. Plant allelopathy connects with endophyte has been suggested [10],[11].

To screen microorganism for molluscicidal activity is one of the most promising categories in biomolluscicides [12] . Bacteria and actinomycete are reported microorganisms capable of molluscicidal activity in China [13],[14] . Pseudolarix kaempferi Gord is a Chinese endemic species, which is one of the common and representative plants in China, and used as Traditional Chinese Medicines [15] . 106 strains of endophytes were isolated from branches and leaves of P. kaempferi Gord [16] . JJ18 is one strain of the endophytes isolated. Studies have confirmed that JJ18's fermentation broth has molluscicidal activity [17] . On the basis, the present study focused on molluscicidal activity of extracts of JJ18 broth, and on the classification of the species of JJ18 by their morphology characteristics cultured in potato dextrose agar (PDA) medium and by molecular biology.


   Material and Methods Top


Endophyte

JJ18 is one strain of endophytes isolated by Jia He [16] from P. kaempferi Gord, and a voucher specimen is kept in the Pharmacognosy Laboratory, College of Pharmacy, Jiangsu University.

Animals

Snails of O. hupensis with relatively uniform in size (1.1±0.15 cm in shell height) were collected from the beach of the Yangtze River near Zhenjiang. They were acclimatized in the laboratory at room temperature (25±2°C) for 24h.

Preparation of samples

JJ18 broth (medium: potato20%, glucose2%, the other is water) was treated by centrifugation in 5000r/min and the supernatant, that is to say, the extracellular moiety of broth with pH3, was obtained. The supernatant was salified to pH7 with NaOH, then 6 volumes (v/v) of 95% ethanol were added to the salified supernatant and kept the solution at 4 °C for 24h, and then the deposition contained in the ethanol mixture was removed by centrifugation. Thus obtained supernatant was concentrated by vacuum evaporator to get alcoholic extract.

Then the alcoholic extract was further extracted by four different solvents one after one: petroleum ether, diethyl ether, ethyl acetate and n-butanol, and the obtained solutions were concentrated by vacuum evaporator to get every a fraction, respectively.

Molluscicidal activity assay of the alcoholic extract.

Molluscicidal activity against O. hupensis was performed according to WHO guiding [18] . 3600 snails were randomly and equally divided into 120 groups with every group containing 30 snails. Dechlorinated tap water was used as diluent. Eight concentrations of 50, 100, 150, 200, 250, 300, 350, and 400mg/L of the alcoholic extract were used to treat test snails, the positive control and negative control groups were performed with 1ppm of niclosamide aqueous and with the dechlorinated tap water, respectively. Every thirty adult snails, as one group, were chosen randomly for the molluscicidal activity test and submerged in every a beaker, containing 300ml of test solutions mentioned above, and kept under normal diurnal lighting condition for 24, 48, 72 and 96h test, respectively. Each test was set in triplicate. At the set time, the suspension in beakers was decanted; the snails were washed with dechlorinated tap water. The test snails were then left in dechlorinated tap water and observed for 72 h, the snails climbing upwards the wall of beakers were judged to be living, and the snails remained in the bottom of beakers were further examined to check mortality by mechanical prodding. The ratio of dead snails to total tested snails was expressed as mortality (%).

Screening of molluscicidal active fractions.

Total 450 snails were randomly and equally divided into 15 groups. Dechlorinated tap water containing 0.03% tween-80 was used as diluent. 200mg/L of the five fractions was used to treat the snails, and the negative control group was performed with the diluent only. The every 30 snails, as one group, were submerged in beakers containing the test solutions for 72h, respectively. Each test was set in triplicate.

Stability of the extracellular broth.

10 ml of extracellular moiety of the broth and 10 ml of its salified one were handled in three ways: (1) The samples heated at different temperature (40°C, 60°C, 80°C and 100°C) for 30 minutes. (2) heated for different periods (30 min 60min 90min 120min 300min) under same temperature (80°C). (3) The samples were placed in an artificial climate box with constant light intensity (˜1200 lux) and temperature (25±1°C), but for different periods (1d, 3d, 6d, 9d and 15d). These treated samples were then diluted to 100ml by dechlorinated tap water as solutions submitted for molluscicidal activity test for 72h to investigate the stability of the molluscicidal active substances. Total 840 snails were randomly and equally divided into 84 groups. Every 10 snails, as one group, were submerged in beakers containing the test solutions for 72h, respectively. Each test was set in triplicate. The other conditions and procedures of the currently mentioned test were the same as mentioned above.

Glycogen (Gn) and Total protein (TPr) assay.

Dechlorinated tap water was used as diluent. Five concentrations of 50, 100, 150, 200 and 250mg/L of the alcoholic extract, which were less than the LC50 value in the case of submerged period 48h, were used to treat O. hupensis snails. The negative group was performed with the diluent only. Total 1200 snails were randomly and equally divided into 15 groups. Every 80 snails, as one group, were submerged in beakers containing the test solutions for 48h, respectively. Each test was set in triplicate. After exposure for 48 h, the living snails were taken out from the beaker and its soft tissues were weighed before and after drying in oven for 24 h at 40ΊC, respectively, the weight ratio of dry/wet were calculated and then the dried soft tissue was grounded into fine powder. Then 2ml aqueous of 30% KOH was added to the test tube with 10 mg of the powder and incubated in boiling water for 20 min, and then cooled to room temperature. Finally 10 ml ethanol was added to the tube after cooling. Glycogen content was analyzed by anthrone colorimetric method.

30mg of the powder were used and the TPr content was detected with KND-04 Kjeldahl nitrogen detection device, and calculated as: (TPr) %=6.25ΧN%.

Statistical analysis.

The molluscicidal activity test data were statistically analyzed by SPSS13.0, and the result was expressed as mean ±standard error. The LC50 and LC90 values were calculated by the probit analysis.

JJ18's species classification by Morphology.

The genus of strain JJ18 was classified by slide culture in PDA medium (Glucose 20%, peptone 20%, agar powder 1.8%, w/v). After 3 days culture, the morphological characteristics were observed with a microscope (using a Χ40 and the Χ100 magnification Olympus BX41, Japan).The genus, which JJ18 belongings to, was then determined according to the observed morphology.

JJ18's species classification by ITS sequence analyzing.

For total DNA extraction from fungus comb (mycelium) or carpophore, we used a simplified Double - Sedimentation Method [19] . The entire region ITS1 - 5.8S - ITS2 was amplified by PCR. The total reaction mixture of 50μL composed of 5μL of 10ΧPCR buffer, 2μL of 5mmol/L dNTP, 2μL of 25mmol/L MgCl2, 1μl of each primer (ITS1 5' TCCGTAGGTGAACCTGCGG 3' and ITS4 5' TCCTCCGCTTATTGATATGC 3' 1μmol/L) 2.5 u of Taq polymerase, 2μL of DNA solution (DNA 20ng), the other is water. The tubes were placed in a thermal cycler (My cycler 1.065, bio-rad USA) for amplification under the following conditions: 36 cycles of (1) denaturation at 94°C for 1 min, (2) annealing at 55°C for 1 min, (3) extension at 72°C for 80s. PCR products were electrophoresed in 1% low-melting temperature agarose gel, visualized with ethidium bromide, and excised separately. The separated PCR products were then further purified with Quick PCR Purification Kit (Shanghai Generay Biotech Co. Ltd) according to the manufacturer's protocol. The sequence of the purified DNA was analyzed by the Generay Co. Ltd (Shanghai, China).

The ITS regions of Aspergillus from GenBank were referred. The alignments were performed with the Clustal W package [20] , and the aligned sequences were corrected manually, focusing on gap positions. DNA sequence data were analyzed to provide pairwise percentage sequence divergence. A phylogenetic tree was created according to the Nucleotide Kimura, 2-parameter method with software of MEGA version3.1. Bootstrap confidence intervals [21] on each branching pattern were calculated for 1000 replications of resampling.

Detection of Ochratoxin A in the alcoholic extract by ELISA.

Ochratoxin A (OTA) calibration and quantitative detection from JJ18 broth's alcoholic extract were carried out according to OTA Kit protocol (Bohom Bio-product Co. Ltd, Nangchang, China).


   Results and Discussion Top


Molluscicidal activity of alcoholic extract of JJ18's broth.

The alcoholic extract of JJ18's broth showed a moderate Molluscicidal activity [Table 1]. The LC50 and LC90 values for different concentrations are shown. There was a significant negative correlation between LC50 values and exposure periods. When increasing the exposure time, the LC50 of the alcoholic extract was decreased from 419.8 mg/L (24 h) to 117.7 mg/L (96 h).

Stability of the extracellular broth.

Extracellular moiety of JJ18 broth was acetose (pH=3), and was thermostabile obviously after salified [Figure 1]. The molluscicidal activity after been salified had no change staying in 80°C for 300min and 100°C for 30min, respectively. The molluscicidal activity was stable within 7 days and then degraded rapidly under the light intensity of 1200 lux. It suggested that the active substance in extracellular moiety of JJ18 broth was thermo-labile under acidic conditions and thermostabile under neutral conditions. That is to say, the active substance could play its role and be little residual under natural conditions.

Glycogen and total protein content of snails' soft tissues tested.

There were no obvious changes of averaged dry and wet weights of soft tissues before and after treatments respectively [Table 2]. The Glycogen content decreased greatly after treatments, ranging from 10.42 % to 28.03 % [Table 3]. The decreasing rate was parallel to the molluscicidal activity. The stronger the molluscicidal activity, the more decrease the glycogen content. The total protein content [Table 4] also changed after treatments, ranging from 16.50% to 22.72%, but there was no linear relationship between molluscicidal activity and protein content decreasing rate.

Classfication of JJ18's species.

JJ18 was considered belonging to an Aspergillus according to its morphology characteristics cultured in PDA medium [Figure 2]

The rDNA ITS sequence described herein has been assigned GenBank Accession No. EF660198. The rDNA ITS sequence analysis showed that the sequence of JJ18 had a higher similarity to those of Aspergillus niger and the differences were located in ITS1 and ITS2 areas, which both belong to variable region. Accordingly, JJ18 strain should been classified into Aspergillus niger [Figure 3].

Screening of the active fraction and possible active substance of the alcoholic extract.

The result of molluscicidal activity with concentration 200mg/L of five fractions showed that the n-butanol extract had the best effect [Figure 4].

The above investigation showed that the fermentation broth of JJ18 possesses strong acidic property, its molluscicidal active substances are thermostabile under neutral salified conditions and the unknown substance can be degraded under natural illumination condition, and it had been known that JJ18 belongings to Aspergillus niger. Considering that the property of OTA, which is the most representative toxic metabolic product from Aspergillus niger, is rather similar to the property of the unknown mulluscicidal active substance contained in the JJ18's broth, we presume reasonably the molluscicidal active substance may be OTA (Appendix A). With ELISA analyzing, OTA was actually detected from the alcoholic extract, and its concentration in the extract, although in a very low level, was 5.072ng/g.


   Conclusions Top


The alcoholic extract of extracellular moiety of JJ18 broth has molluscicidal activity which was both time and dose dependent. The molluscicidal active substance was stable in natural conditions within 7 days, therefore it showed that the active substance of extracellular moiety of JJ18 broth can be degraded in natural conditions.

The alcoholic extract of JJ18 can decrease the glycogen content in snail's soft tissues suggests that the abnormity of energy metabolism might be the major factor for the molluscicidal activity [22] .

Further, OTA was detected in the metabolic production, whether it was the molluscicidal active substance is remained for further research. It should be pointed out that OTA is a mycotoxin produced by several species (fungi and moulds) of Aspergillus and Penicillium[23] , and has been widely studied so far since it is considered as a potential human health hazard.

Classification of endophyte on morphologic features and molecular biology was simple, rapid and accurate. It had been proved that ITS sequence could be used in classification and taxonomy of endophyte [24].


   Acknowledgements Top


The authors are thankful to Postgraduates Innovation Program in 2004 (xm04-57), Education Committee of Jiangsu province, China, for financial support. The authors are also thanks to professor Yousheng Liang, director of Jiangsu Institute of Parasitic Diseases, in China, for his technical support.

 
   References Top

1.WHO. The control of Schistosomiasis. Second Report of the WHO Expert Committee. (WHO Technical Rep. Series, 1993) 830.   Back to cited text no. 1      
2.Hong W, Weimin C, Wanxian W, Jianmin Y. Molluscicidal Activity of Neri­um indicum Mill, Pterocarya stenoptera DC, and Rumex japonicum Houtt on Oncomelania hupensis. Biomedical and Environmental Science. 19 : 245-248 (2006).   Back to cited text no. 2      
3.Yang XM, Chen SX, Xia L, Chen J. Molluscicidal activity against On­comelania hupensis of Ginkgo biloba. Fitoterapia. 79 : 250-254 (2008).   Back to cited text no. 3      
4.Eduardo C Oliveira-Filho, Francisco JR Paumgartten. Toxicity of Euphor­bia milii Latex and Niclosamide to Snails and Nontarget Aquatic Species. Ecotoxicology and Environmental Safety. 46 : 342-350 (2000).   Back to cited text no. 4      
5.J de S Luna, AF dos Santos, MRF de Lim, MC de Omena, FAC de Men­donca, LW Bieber, AEG Sant'Ana. A study of the larvicidal and mollus­cicidal activities of some medicinal plants from northeast Brazil. Journal of Ethnopharmacology. 97 : 199-206 (2005).   Back to cited text no. 5      
6.Strobel GA. Endophytes as sources of bioactive products. Microbes and Infection. 5 : 535-544 (2003).   Back to cited text no. 6      
7.Strobel GA. Harnessing endophytes for industrial microbiology. Current Opinion in Microbiology. 9 : 240-244 (2006).   Back to cited text no. 7      
8.Fengan Yu, Weiping Peng, Zhenhua Peng, Zhang Jialai, Lide Liu, Danming Peng. Plant allelopathy effects on Oncomelannia hupensis. Chinese Journal of Applied Ecology. 7 : 407-410 (1996).   Back to cited text no. 8      
9.Wanxian Wang, Yi Yang, Hong Wang, Lihui Shu, Yong Zhang, Jialei Zhang, Jinhua Hou. Effect of cardiac glycosides from Nerium indicum on Oncomelania hupensis. Acta Ecologica Sinica. 26 : 954-959 (2006).  Back to cited text no. 9      
10.Clay K, Holah J. Fungal endophyte symbiosis and plant diversity in succes­sional fields. Science. 285 : 1742-1745 (1999).  Back to cited text no. 10      
11.Wilson D, Carroll GC. Avoidance of high-endophyte space by gall-form­ing insects. Ecology. 78 : 2153-2163 (1997).  Back to cited text no. 11      
12.Xiaonong Zhou. Science on Oncomelannia snails. (Beijing, 2005) 94.  Back to cited text no. 12      
13.Xianglin Chen. Molluscicidal activity against Oncomelania hupensis of Psudomonas conrexa chest. Microbiology. 10 : 215-217 (1983).  Back to cited text no. 13      
14.Ping Tan, Jianming Yang, Ruifen Xiao, Yang Zhang. Influence of Strep­tomyces violaceoruber on the enzyme - his to chemistry in Oncomelania hupensis. Acta Zoologica Sinica. 52 :109-114 (2006).  Back to cited text no. 14      
15.The Pharmacopoeia Comittee of People's Republic of China. China Phar­macopoeia. (Beijing, 2005) 14.  Back to cited text no. 15      
16.Jia HE, Jun CHEN, Qimei ZHAO, Hongbing QI. Study on fast screen­ing anti-fungus activity of endophytes from Pseudolarix kaempferi. China Journal of Chinese Materia Medica. 31 : 1759-1763 (2006).  Back to cited text no. 16      
17.Shangbin Guo, Jun Chen, Jia He, Xi Cheng, Nan Zhong. Molluscicidal ex­periment of endophytes from Pseudola rix kaempferi Gord. Chinese Journal of Schistosomiasis Control. 19 :285-288 (2007).  Back to cited text no. 17      
18.WHO. Reports of the scientific working group on plant molluscicides, TDR/SCH.SWG/4/83.3. (1983).  Back to cited text no. 18      
19.Charles S. Hoffman, Winston Fred. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for trausformation of Es­cherichia coli. Gene. 57 : 267-272 (1987).  Back to cited text no. 19      
20.Thompson JD., Higgins DG, Gibson TJ, Clustal W. Improving the sen­sitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Research. 22 : 4673-4680 (1994).  Back to cited text no. 20      
21.Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 39 : 783-791 (1985).  Back to cited text no. 21      
22.Genfa Wang, Gengming Song, Yun Qiu. Basic components of snails and the effect of bromide acetamide. Chinese Journal of Zooogyl. 24 : 4-6 (1989).   Back to cited text no. 22      
23.Leong SL, Hocking AD, Pitt JI, Kazi BA, Emmett RW, Scott ES. Austra­lian research on ochratoxigenic fungi and ochratoxin A. International Journal of Food Microbiology. 111 : S10-S17 (2006).  Back to cited text no. 23      
24.Xin Zhang, YI Li, Yukun Wei, Yinhua Wang, LinFeng. Distribution and rDNA-ITS sequence analysis of Epichloλ endophyte symbiosis with Ach­natherum sibiricum in mid-and eastern Inner Mongolia Steppe. Acta Eco­logica Sinica. 27 : 2904-2910 (2007).  Back to cited text no. 24      


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
    Introduction
    Material and Methods
    Results and Disc...
    Conclusions
    Acknowledgements
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed2182    
    Printed228    
    Emailed0    
    PDF Downloaded61    
    Comments [Add]    

Recommend this journal